Review





Similar Products

90
ATCC atcc 28301
Atcc 28301, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/atcc 28301/product/ATCC
Average 90 stars, based on 1 article reviews
atcc 28301 - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Thermo Fisher glud1 antibody pa5-28301
Glud1 Antibody Pa5 28301, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/glud1 antibody pa5-28301/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
glud1 antibody pa5-28301 - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology rfc4
Rfc4, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rfc4/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
rfc4 - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

90
Signalway Antibody tim- 3 clone 28301 antibody
Tim 3 Clone 28301 Antibody, supplied by Signalway Antibody, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tim- 3 clone 28301 antibody/product/Signalway Antibody
Average 90 stars, based on 1 article reviews
tim- 3 clone 28301 antibody - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology anti rfc4 antibodies
ATAD5 URM is important for efficient PCNA unloading. ( A ) RFC2-5 binding was not affected by URM mutations. URM mutants were transiently expressed in 293T cells. To monitor the RFC2-5 binding, FLAG-immunoprecipitation was performed and co-isolated <t>RFC4</t> was analyzed by immunoblot. The amount of co-purified RFC4 was not changed by URM mutations. ( B ) Coomassie blue stained SDS-PAGE of URM mutant ATAD5 (812–1844)-RLC. URM mutants formed a pentameric complex with RFC2-5. ( C ) URM mutants are defective in PCNA unloading in vitro. Top —in vitro PCNA unloading assay was performed with URM mutants. Compared to wild type, URM mutants showed defects in releasing PCNA from DNA. Bottom —quantification of the relative PCNA amount on DNA. Error bars indicate standard deviation ( n = 2).
Anti Rfc4 Antibodies, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti rfc4 antibodies/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
anti rfc4 antibodies - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology anti rfc4
ATAD5 URM is important for efficient PCNA unloading. ( A ) RFC2-5 binding was not affected by URM mutations. URM mutants were transiently expressed in 293T cells. To monitor the RFC2-5 binding, FLAG-immunoprecipitation was performed and co-isolated <t>RFC4</t> was analyzed by immunoblot. The amount of co-purified RFC4 was not changed by URM mutations. ( B ) Coomassie blue stained SDS-PAGE of URM mutant ATAD5 (812–1844)-RLC. URM mutants formed a pentameric complex with RFC2-5. ( C ) URM mutants are defective in PCNA unloading in vitro. Top —in vitro PCNA unloading assay was performed with URM mutants. Compared to wild type, URM mutants showed defects in releasing PCNA from DNA. Bottom —quantification of the relative PCNA amount on DNA. Error bars indicate standard deviation ( n = 2).
Anti Rfc4, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti rfc4/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
anti rfc4 - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology anti rfc4 h 183
ATAD5 URM is important for efficient PCNA unloading. ( A ) RFC2-5 binding was not affected by URM mutations. URM mutants were transiently expressed in 293T cells. To monitor the RFC2-5 binding, FLAG-immunoprecipitation was performed and co-isolated <t>RFC4</t> was analyzed by immunoblot. The amount of co-purified RFC4 was not changed by URM mutations. ( B ) Coomassie blue stained SDS-PAGE of URM mutant ATAD5 (812–1844)-RLC. URM mutants formed a pentameric complex with RFC2-5. ( C ) URM mutants are defective in PCNA unloading in vitro. Top —in vitro PCNA unloading assay was performed with URM mutants. Compared to wild type, URM mutants showed defects in releasing PCNA from DNA. Bottom —quantification of the relative PCNA amount on DNA. Error bars indicate standard deviation ( n = 2).
Anti Rfc4 H 183, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti rfc4 h 183/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
anti rfc4 h 183 - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

90
ATCC gccgctttagctcagttggtagagcacatcattcgtaatgatggggtcgcgtgttcgagt cacgcaagcggcacca brucella suis atcc 23445 chri
ATAD5 URM is important for efficient PCNA unloading. ( A ) RFC2-5 binding was not affected by URM mutations. URM mutants were transiently expressed in 293T cells. To monitor the RFC2-5 binding, FLAG-immunoprecipitation was performed and co-isolated <t>RFC4</t> was analyzed by immunoblot. The amount of co-purified RFC4 was not changed by URM mutations. ( B ) Coomassie blue stained SDS-PAGE of URM mutant ATAD5 (812–1844)-RLC. URM mutants formed a pentameric complex with RFC2-5. ( C ) URM mutants are defective in PCNA unloading in vitro. Top —in vitro PCNA unloading assay was performed with URM mutants. Compared to wild type, URM mutants showed defects in releasing PCNA from DNA. Bottom —quantification of the relative PCNA amount on DNA. Error bars indicate standard deviation ( n = 2).
Gccgctttagctcagttggtagagcacatcattcgtaatgatggggtcgcgtgttcgagt Cacgcaagcggcacca Brucella Suis Atcc 23445 Chri, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gccgctttagctcagttggtagagcacatcattcgtaatgatggggtcgcgtgttcgagt cacgcaagcggcacca brucella suis atcc 23445 chri/product/ATCC
Average 90 stars, based on 1 article reviews
gccgctttagctcagttggtagagcacatcattcgtaatgatggggtcgcgtgttcgagt cacgcaagcggcacca brucella suis atcc 23445 chri - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

Image Search Results


ATAD5 URM is important for efficient PCNA unloading. ( A ) RFC2-5 binding was not affected by URM mutations. URM mutants were transiently expressed in 293T cells. To monitor the RFC2-5 binding, FLAG-immunoprecipitation was performed and co-isolated RFC4 was analyzed by immunoblot. The amount of co-purified RFC4 was not changed by URM mutations. ( B ) Coomassie blue stained SDS-PAGE of URM mutant ATAD5 (812–1844)-RLC. URM mutants formed a pentameric complex with RFC2-5. ( C ) URM mutants are defective in PCNA unloading in vitro. Top —in vitro PCNA unloading assay was performed with URM mutants. Compared to wild type, URM mutants showed defects in releasing PCNA from DNA. Bottom —quantification of the relative PCNA amount on DNA. Error bars indicate standard deviation ( n = 2).

Journal: Cells

Article Title: Distinct Motifs in ATAD5 C-Terminal Domain Modulate PCNA Unloading Process

doi: 10.3390/cells11111832

Figure Lengend Snippet: ATAD5 URM is important for efficient PCNA unloading. ( A ) RFC2-5 binding was not affected by URM mutations. URM mutants were transiently expressed in 293T cells. To monitor the RFC2-5 binding, FLAG-immunoprecipitation was performed and co-isolated RFC4 was analyzed by immunoblot. The amount of co-purified RFC4 was not changed by URM mutations. ( B ) Coomassie blue stained SDS-PAGE of URM mutant ATAD5 (812–1844)-RLC. URM mutants formed a pentameric complex with RFC2-5. ( C ) URM mutants are defective in PCNA unloading in vitro. Top —in vitro PCNA unloading assay was performed with URM mutants. Compared to wild type, URM mutants showed defects in releasing PCNA from DNA. Bottom —quantification of the relative PCNA amount on DNA. Error bars indicate standard deviation ( n = 2).

Article Snippet: The following antibodies were used: anti-PCNA (Rabbit), anti-LaminB1 antibodies (Abcam, Cambridge, UK); anti-FLAG, anti-HA antibodies (Merck, Darmstadt, Germany); anti-PCNA (mouse), anti-RFC4 antibodies (Santa Cruz, Dallas, TX, USA); anti-Myc antibody (Merck, Darmstadt, Germany).

Techniques: Binding Assay, Immunoprecipitation, Isolation, Western Blot, Purification, Staining, SDS Page, Mutagenesis, In Vitro, Standard Deviation

ATAD5 C-terminus is required for efficient PCNA unloading. ( A ) ATAD5 C-terminus is conserved among species. Primary sequences of ATAD5 C-terminus from different species are aligned. ( B ) ATAD5 C-terminus is required for stable RFC2-5 binding. ATAD5 (812–1844) or ATAD5 (812–1799) were transiently expressed and FLAG-immunoprecipitation was performed. The amount of co-precipitated RFC4 was reduced with ATAD5 (812–1799). ( C ) ATAD5- C-terminus is essential for PCNA unloading. ATAD5 (812–1844) or ATAD5 (812–1799) were transiently expressed in ATAD5 depleted cells. After chromatin fractionation, the amount of chromatin-bound PCNA was monitored by immunoblot. Chromatin-unbound soluble fractions were shown to examine total amount of each protein. ATAD5 (812–1799) failed to reduce PCNA level on chromatin compared to ATAD5 (812–1844). Number below the PCNA blot indicates relative amount of chromatin-bound PCNA.

Journal: Cells

Article Title: Distinct Motifs in ATAD5 C-Terminal Domain Modulate PCNA Unloading Process

doi: 10.3390/cells11111832

Figure Lengend Snippet: ATAD5 C-terminus is required for efficient PCNA unloading. ( A ) ATAD5 C-terminus is conserved among species. Primary sequences of ATAD5 C-terminus from different species are aligned. ( B ) ATAD5 C-terminus is required for stable RFC2-5 binding. ATAD5 (812–1844) or ATAD5 (812–1799) were transiently expressed and FLAG-immunoprecipitation was performed. The amount of co-precipitated RFC4 was reduced with ATAD5 (812–1799). ( C ) ATAD5- C-terminus is essential for PCNA unloading. ATAD5 (812–1844) or ATAD5 (812–1799) were transiently expressed in ATAD5 depleted cells. After chromatin fractionation, the amount of chromatin-bound PCNA was monitored by immunoblot. Chromatin-unbound soluble fractions were shown to examine total amount of each protein. ATAD5 (812–1799) failed to reduce PCNA level on chromatin compared to ATAD5 (812–1844). Number below the PCNA blot indicates relative amount of chromatin-bound PCNA.

Article Snippet: The following antibodies were used: anti-PCNA (Rabbit), anti-LaminB1 antibodies (Abcam, Cambridge, UK); anti-FLAG, anti-HA antibodies (Merck, Darmstadt, Germany); anti-PCNA (mouse), anti-RFC4 antibodies (Santa Cruz, Dallas, TX, USA); anti-Myc antibody (Merck, Darmstadt, Germany).

Techniques: Binding Assay, Immunoprecipitation, Fractionation, Western Blot